Zvezde Granda - Cela emisija 09 - ZG 2019/20 - 16.11.2019.

Subotom u 21h TV Prva, Nova BIH, Kanal 5
📸 Follow Zvezde Granda:
Instagram➤ zvezdegranda?hl=sr
Facebook➤ sr-rs. ZvezdeGrandaPrva
Twitter➤ Zvezde_Granda
Zvanični portal➤ grand.online/
Menadzment: +381 63 1509 888 , +381 64 11 76122
Zvanični portal: grand.online/

Label and copyright: GrandProduction
Zabranjeno svako kopiranje video i/ili audio snimaka i postavljanje na druge kanale!
Copying, re-uploading and illegally distributing this copyrighted work is strictly prohibited!
#ZvezdeGranda
#GrandProduction

Преузми

Приказа
802,870

Коментара

  • Sto se tice kulture i vaspitanja, Karleusini roditelji su mnogo traljavo obavili svoju roditeljsku duznost.

    Stasa NikolicStasa NikolicПре 5 дана
  • <a href="#" class="seekto" data-time="118">1:58</a>:01

    KDM BESTKDM BESTПре месец
  • <a href="#" class="seekto" data-time="70">1:10</a>:30

    KDM BESTKDM BESTПре месец
  • jelena volim te!!

    Nerma MujkovicNerma MujkovicПре месец
  • Koliko su ova Marija i Karleusa bahate i bezobrazne..niti kulture, odgoja...samo veliki ego..Gospodo Nedo, naucite ih kako se razgovara i ponasa...jedna se samo dere a druga skida.

    Ivana Božić-JurasIvana Božić-JurasПре месец
  • Ti Jelena, da se nisi toliko izoperisarala, ostala bi teska rugobetina, a ni operacije ti nisu pomogle i dalje si ogavna, a pri tome si dzukeletina i ulicarka.

    S JS JПре месец
  • Tebi je Jelena majka trebalo da nalupa svaki dan 5 samara, jer si jedna dzukela, ulicarko.

    S JS JПре месец
  • Da budemo realni, svi su teska seljadija, mene cudi da je Ana Bekuta prihvatila da bude deo ove sabanerije. Neda Ukraden je za njih pojam. Od ostalih mi se povraca, na celu sa ovim Sasom Popovicem.

    S JS JПре месец
  • Koliko su ne kulturni

    Laky daciLaky daciПре 2 месеца
  • Još jedan u nizu dokaza kakva je Dragana Mirkovic kao ćovek zapravo. Naklon do poda ženo.

    Martin RadulovskiMartin RadulovskiПре 2 месеца
  • Kako je Karleuša neorientirana - ne zna ko je Neda Ukraden.

    gucagucagucagucagucagucaПре 2 месеца
  • Koja je seljancura ova Karleusa, pa davno takvu nisam videla!!! Ama ko je to nju slagao da ona ima blagog pojma sta je to 'zvezda'???? A kamoli da se ona priblizila tome!!!! Ja ne volim narodnu muziku nimalo, ali Viki, koju Karleusa non stop proziva, moze da joj drzi casove iz svega, a ne samo muzike!!!! I kako treba da se izgleda, i kako da se slusa, i sta je vazno u ovom takmicenju, i kako treba da se ponasa prema takmicarima, ama iz svega da je makar malo poduci (ako je nju poduciti uopste moguce za bilo koga!!!) Izbacite je AKO BOGA ZNATE!!!!!

    Nina GrozdanovicNina GrozdanovicПре 2 месеца
  • Najgora epizoda do sada.Bezveze,pre lode

    josipa prskalojosipa prskaloПре 2 месеца
  • Jelena nit malo nema respekta uzas... Marija za njom jasi

    Sany 10Sany 10Пре 2 месеца
  • <a href="#" class="seekto" data-time="128">2:08</a>:53 😂

    Zalutali MaliZalutali MaliПре 3 месеца
  • Svi voze svoj auto samo Neda Ukraden

    Maki SzeniakMaki SzeniakПре 3 месеца
  • *ZG - EM 09* *<a href="#" class="seekto" data-time="4">00:04</a>:12** PEPITA MARINKOVA* *<a href="#" class="seekto" data-time="12">00:12</a>:42** MANJA MARKOVIĆ (DSB)* *<a href="#" class="seekto" data-time="23">00:23</a>:37** EKREM PELEŠ (JK)* *<a href="#" class="seekto" data-time="37">00:37</a>:11** NEVENA PETRONIĆ (ĐD)* *<a href="#" class="seekto" data-time="45">00:45</a>:32** JELENA KOSTELNIK* *<a href="#" class="seekto" data-time="52">00:52</a>:37** BRANKA ŠAULA (VM)* *<a href="#" class="seekto" data-time="60">01:00</a>:05** SANDRA SPREMIĆ* *<a href="#" class="seekto" data-time="66">01:06</a>:14** DESPINA RISTOVA* *<a href="#" class="seekto" data-time="72">01:12</a>:38** MIROSLAV MURATOVIĆ* *<a href="#" class="seekto" data-time="80">01:20</a>:53** NEMANJA RAJAK (DSB)* *<a href="#" class="seekto" data-time="91">01:31</a>:41** STOJAN SIMIJANOVIĆ (NEDA UKRADEN)* *<a href="#" class="seekto" data-time="96">01:36</a>:47** SOFIJA ĐEKIĆ (JK)* *<a href="#" class="seekto" data-time="105">01:45</a>:47** NEMANJA MARKOVIĆ (NEDA UKRADEN)* *<a href="#" class="seekto" data-time="115">01:55</a>:07** DUŠAN VITASOVIĆ (DSB)* *<a href="#" class="seekto" data-time="123">02:03</a>:20** ALEN SKOPLJAK (NEDA UKRADEN)* *<a href="#" class="seekto" data-time="130">02:10</a>:06** TATJANA NEPRIČIĆ (JK)* *<a href="#" class="seekto" data-time="138">02:18</a>:14** DALIBOR VUJIČIĆ (NEDA UKRADEN)*

    Matt WhiteMatt WhiteПре 3 месеца
  • Do kad će ovoj Sanji pustiti da priča što joj padne na pamet??!! Totalno neprofesionalno! Cura je lijepa to da ali brate što joj izlazi iz usta ,mislim zbilja,jedna voditeljica da govori nešto! Daj neka je netko zaustavi 😒

    Mrs KMrs KПре 3 месеца
  • Bravo Nedo legendo ova plajbekusica misli da je neka zvjezda a goli k sta od pjevacice sta od covjeka

    Ilijana MarinkovicIlijana MarinkovicПре 3 месеца
  • Lako je talentovanog pevaca uzeti i napraviti zvezdu uzmite malo losijeg pa se pohvalite da ste stvorili pevaca mislim da ziri u kompletu sere sa sasom

    P MP MПре 3 месеца
  • Brate ne moze panik i za one u ritmu i za one van ritma nije fer momak alen ima sluha

    jela Jelenajela JelenaПре 3 месеца
  • Ako ove gospode nece ja cu... Kakav covek ju

    jela Jelenajela JelenaПре 3 месеца
  • Odkad Neda prica ekavski

    Ajeta HozanovicAjeta HozanovicПре 3 месеца
  • Puno loših kandidata.

    Vladan VidojevićVladan VidojevićПре 3 месеца
  • <a href="#" class="seekto" data-time="62">1:02</a>:14

    Josip BabićJosip BabićПре 3 месеца
  • Koja nekultura

    Katarina MajerKatarina MajerПре 3 месеца
  • Malo više više poštovanja in razumevanja do kandidata u nekim komentarima ne bi škodilo nivoju emisije.

    Suzana ČurinSuzana ČurinПре 3 месеца
  • Ova seljanka se česlja u ziriju. Boze moj, pocet ce i nokte rezati. Dzaba pare, dzaba sve, nikad dame od Karleuse

    Oposum Pod StresomOposum Pod StresomПре 4 месеца
  • Shvatio sam ja taktiku našeg dragog bosanac. ..logično je uzima manje bolje takmičare ali da imaju potencijala i koji nisu dali sve od sebe iz razloga je da ih i malo poboljša vidi se rezultat i prolaze dalje ...dok takmičari koji su pokazali sve sto mogu i na kojima se vidi da je to maximum ne smiju nikako past jer automatski gube od njih se očekuje više...vrlo pametno 😆👌

    DOMI VUDOMI VUПре 4 месеца
  • <a href="#" class="seekto" data-time="132">2:12</a>:30 Hvala Bogu ima nas i ovakvih.

    Commentator541Commentator541Пре 4 месеца
  • Koji krkan je ova Marija, a i Karleusa ide s njom pod ruku. Ovakvo ponasanje je dno dna.

    Tanja A.Tanja A.Пре 4 месеца
  • Jelena, uz dužno poštovanje vašim godinama, naučite se kulturi. Naučite skupljati lajkove bez pravljenja scena i omalovažavanja drugih. Lp.

    tea boguttea bogutПре 4 месеца
  • Ja mislim da je krajnje vreme produkciju da se zahvale i da da otkaz mariju i jelenu pa i bosanac za njihove dosagjivanje i maltretiranje decu.aj pod hitno

    Goran AgusevGoran AgusevПре 4 месеца
  • Neda je dama, zvezda,lepotica, narodna, pametna, obrazovana, kulturna i ljubazna!!! LEGENDA!!!

    Kata M BKata M BПре 4 месеца
  • Zasto Alen kaze Nedi "Hvala ti lijepo" je zato u u Svedskoj se svima kaze Ti! A one dame sa sesirom i pored Bez nemoraju komentirati prije nego sto ne saznaju razlog....

    Kata M BKata M BПре 4 месеца
  • Ponasanje nasih "kao zvezda" dno dna........koji show business...ovo ponasanje nemoze nikako da prodje a to sto zamisljaju da su neko i nesto to je nesto drugo. Svaka cast izuzecima a to su Viki i Neda

    Jean JeanJean JeanПре 4 месеца
  • Viki mi je lepsa u licu od Jelene

    Sese12 AssSese12 AssПре 4 месеца
  • Marija i Jelena bas nekulturne

    Sese12 AssSese12 AssПре 4 месеца
  • Ovo je smesno i sramotno.Ziri je apsolutno ne kompetentan za ocenjivanje.Zalosni ste svi do jednog.

    Nemanja JokicNemanja JokicПре 4 месеца
  • <a href="#" class="seekto" data-time="60">1:00</a>:54 Opasan corpi

    Milos NikicMilos NikicПре 4 месеца
  • <a href="#" class="seekto" data-time="62">1:02</a>:14

    Edo 642Edo 642Пре 4 месеца
  • <a href="#" class="seekto" data-time="765">12:45</a> Manja Markovic👑

    uros markovicuros markovicПре 4 месеца
  • Folk

    Stefan carStefan carПре 4 месеца
  • Svi statiji od 30 godine , ne reba da se takmice u ZG, Do 30 godina sto si uspio , uspio si.

    avgust 1989avgust 1989Пре 4 месеца
  • Nek mi kaze neko dge jelena navreduje natprevaruvac/cka kako krava i vika muu koja min i sek

    Matea1001Matea1001Пре 4 месеца
  • Sofija Đekić 😍😍👏👏

    Mr KlausMr KlausПре 4 месеца
  • Koji smor od emisije. Ali sve komplet. neinspirativno. Bar da su napravili show u ziriju...

    Mr. CreativeMr. CreativeПре 4 месеца
  • Kaze se izuzeci Sanja a ne izuzetci🙄

    Ljiljana MiljicLjiljana MiljicПре 4 месеца
  • Bilo je dobri kandidata .Svaka cast na blagoj toleranciji pjevaca (kandidata) a ne šikaniranju i tuširanju.! Sve COOL ..pozdrav iz Kanade! 🍁👍💕🍷🌹👌🍁

    Tonchy ShultzTonchy ShultzПре 4 месеца
  • Kakva djubrad, dobre pevace I koji pevaju normalnu muziku namerno eliminisu a lose ostavljaju. E srbijo, sta ti dopustas. Poljubila bih Nedu zbog kako je dala BUDALA a Karleusi 😂

    SERBONASERBONAПре 4 месеца
  • Joj Jelena bezobrazna si do bola

    Lenka JanjicLenka JanjicПре 4 месеца
  • Slabi pjevaci

    la bellala bellaПре 4 месеца
  • rs-projects.info/it/video/hqyYz5i0p2GhqZU Ovu ste malu ponizavali u NNK, kao i nekoliko curica iz BiH. Ko osim Marije moze ovo otpevati kao ova mala ?

    kerim mrganjackerim mrganjacПре 4 месеца
  • jelena 💩👎👎👎👎👎

    Dejan VeselinovDejan VeselinovПре 4 месеца
  • Ovu Jelenu treba izbaciti iz zirija. Ona da im zirira a losije peva od vecine. Dosadna je. Taj cirkus koji ona izvodi moze samo u rijalitiju proci.

    Johana JkJohana JkПре 4 месеца
  • Viki carica,ne znam zašto je Saša stalno ponižava.

    Petra RadivojevicPetra RadivojevicПре 4 месеца
  • Joj, jao... ta voditeljka...

    gucagucagucagucagucagucaПре 4 месеца
  • <a href="#" class="seekto" data-time="1836">30:36</a> kad mi kazu prvo ce raditi na kilazi, pa nije dozao u emisiju zivot na vagi nego na zvijezde granda, pjevanje je valjda bitnije🔫 .koliko ima poznatih licnosti koji su deblji a poznatiji su od njega... <a href="#" class="seekto" data-time="112">1:52</a>:25 tako je Bosanac

    Lejla KanuricLejla KanuricПре 4 месеца
  • Zašto se Karleuša toliko uzvrpoljila kad Neda kaže istinu oko zevanja na playback?

    gucagucagucagucagucagucaПре 4 месеца
  • Pola zirija da se promeni Aca Lukas za Davida je svemir... Marija nema interesovanja da bude tamo... Jelena Karleusa nevaspitanjem da je los primer deci i omladini...

    Milos Zeljkov PetkovicMilos Zeljkov PetkovicПре 4 месеца
  • Zadruga SVE TUCE VIDEO rs-projects.info/it/video/oMenuqargKVgp5k

    Naiger MNaiger MПре 4 месеца
  • nisam dugo gledao zvezda Granda a sada posle prvog komentara stare Jelene (primitivne) mora da kazem da ta ustaranja jos gora neno pre.Kada neka devojka lepsa i mladja ona u sred pesme laje da je ometne ....ne ne .. To tako primitivno nema ni u jednu drzavu. Ne Hvala. a pod drugu Tacku - nemoze se u 2019 godine gde se kvalitet 4K po svetom gleda a kod nas 480p da bole oci! Nein Danke

    Milo FotoMilo FotoПре 4 месеца
  • kako ovi pjevaci pjevaju uzivo uzas ljepse pjevaju ovi takmirari.

    Hadzira KudicHadzira KudicПре 4 месеца
  • Marija, djaba ti persiras kad podjebavas🥳

    Mona LisaMona LisaПре 4 месеца
  • Slava moze coveka u „nebesa“ da baci Da da 🧐

    Mona LisaMona LisaПре 4 месеца
  • Ja mislim da dok se neko nenadje da izubija ove iz zirija za njihovo vredjanje, nece oni da se opamete 🤨

    Mona LisaMona LisaПре 4 месеца
  • Tebi Jelena samo one stvari na pameti 🤣🤣🤣

    Mona LisaMona LisaПре 4 месеца
  • Šaula lici na amy winehouse

    neki vamoneki vamoПре 4 месеца
  • Da li i ja da se prijavim? 😂

    Marija MaticMarija MaticПре 4 месеца
  • kad ce vise da izbace ovu ludacu jelenu muka mi je od nje

    Lily CebicLily CebicПре 4 месеца
  • Dosla samo zbog Alena i Sendi da gledam :* :) Bravoo Alene bio si najbolji veceras

    Aida BesirevicAida BesirevicПре 4 месеца
  • Neda Ukraden brings a bit of decorum to the seriously amateur howdy doooo deeee hour...Go Neda!

    ArtistesArtistesПре 4 месеца
  • Ali vrh ironije je kad se Marija "zgrozila" kad se decko obratio Nedi na "ti", a zapravo Marija zajedno sa ostatkom zirija pretstavljaju vizualni prikaz poјma "NEKULTURA"...

    DLB01992DLB01992Пре 4 месеца
    • komentari bez vrijedjanja... daj Boze da se to ponovi, svaka emisija mi je bila uzivanje...

      Ask to seduce MissAsk to seduce MissПре 4 месеца
  • Informacija za Mariju. Kad je Alen iz Svedske nastupijo nije iz nepostovanja rekao Nedi hvala ti puno, vec zato sto se u Svedskoj ne persira starijim osobama, vec se obracas ljudima sa ti. Tako da ne mora da sudi, dijete je sigurno rodjeno u Svedskoj i nije naucen persirat neovisno godinama, polozaju itd. Svaka cast Alen👏

    123456789 123456789123456789 123456789Пре 4 месеца
  • Sta se desava za grandom ste ga prodali i drugo.ime ce dobiti mozda grijesim a vi objasnite

    mirjana ratajmirjana ratajПре 4 месеца
  • i ovaj zorz poleteo usima visokoooo

    C.S.A.C.S.A.Пре 4 месеца
  • Ova Pepita je senzibilna, nježna, nema iskustva, ali talentovanija, muzikalnija od Karleuše 100 puta i ova to negdje osjeti i zato i vrijeđa, prejadno... Karleuša pjeva na plejbek i skače po bini, nema šta drugo. A dobro je i kad pjeva na plejbek, kad počne uživo požale ljudi i što su došli da je gledaju...

    Vanja B.Vanja B.Пре 4 месеца
  • ovaj sasa je najveci olos na estradi

    C.S.A.C.S.A.Пре 4 месеца
  • Koji je ova Karleuša retardirani skot, ne da mi se gledati emisija zbog tog idiota..

    Vanja B.Vanja B.Пре 4 месеца
  • Ovaj Alen bas lijepo pijeva,njima niko nevalja!

    Zorana KojicZorana KojicПре 4 месеца