Zvezde Granda - Cela emisija 26 - ZG 2019/20 - 14.03.2020.

Subotom u 21h TV Prva, Nova BIH, Kanal 5
📸 Follow Zvezde Granda:
Instagram➤ zvezdegranda?hl=sr
Facebook➤ sr-rs. ZvezdeGrandaPrva
Twitter➤ Zvezde_Granda
Zvanični portal➤ grand.online/
Menadzment: +381 63 1509 888 , +381 64 11 76122
Label and copyright: GrandProduction
Zabranjeno svako kopiranje video i/ili audio snimaka i postavljanje na druge kanale!
Copying, re-uploading and illegally distributing this copyrighted work is strictly prohibited!
#ZvezdeGranda
#GrandProduction

Преузми

Приказа
951,163

Коментара

  • Jao Sasa Popovicu seljacino ogavna "jedva cekamo da nas bacite na kolena, pogotovo Jelenu"... FUJ STOKO

    Ptao TomPtao TomПре 12 сати
  • Draga Sanja sta obuce :O tako finu zenu u tako rogobatne modne kombinacije oblacite..... ovo je uzas

    Ladyy DamaLadyy DamaПре 18 сати
  • Voja:Jelena u extazi Natasa ide ka tome🤣🤣🤣

    bosnian_kid . debosnian_kid . deПре 22 сата
  • Jbm ti Koronu! Prekinuo nam najjaču sezonu u poslednjih 5-6 godina! Tvrdim da bi za jedno 2 kruga preostali takvi pevači i pevačice da bi bilo "klanja" među žirijem ko da ide dalje!

    Dimitrije StefanovicDimitrije StefanovicПре 22 сата
    • Zasto ne objavljuju novu emisiju

      Ptao TomPtao TomПре 12 сати
  • Jao Sasa Popovicu seljacino ogavna "jedva cekamo da nas bacite na kolena, pogotovo Jelenu"... FUJ STOKO

    Ask to seduce MissAsk to seduce MissПре дан
  • Adnan Kotoric isti bivsi golman Liverpoola Mignolet?! 🤗

    southboysouthboyПре дан
  • RIJADE JAVI MI SE NA MAIL isakmladen@gmail.com Ima na svadbi, svadbi moje dece i svim proslavama da mi pevaš. Ne pitam za cenu. Koliko god hoćeš.

    fouoii gyhhfouoii gyhhПре дан
  • NATASA VODENICAR, FUJ ZA ZIRI!!! OVO NIJE NI ZA GLEDAT BEZ PEVANJA A NEDAJ BOZE KADA ZAPEVA!!! KAO I BOSANCEVA DZIDZA,ISTA KATEGORIJA!!!

    Kafana SvakaKafana SvakaПре дан
    • Sanela toppp 🙋🙋 Vrh... Prsti mala od seksepila😱

      Ask to seduce MissAsk to seduce MissПре дан
  • rs-projects.info/it/video/q9OczWe1Z6KXf6I

    Sta te BrigaSta te BrigaПре дан
    • Bravo vanja....izgledas divno i prelepo si otpevala👏👏👏👏👏

      fouoii gyhhfouoii gyhhПре дан
  • Neka je Avdo dao jedan gospodski odgovor JK....Suknu ga u zadnjoj minuti.

    bofooit gojobofooit gojoПре 2 дана
  • promjente voditelja majke vaam kakav je on mentol

    amela osmicamela osmicПре 2 дана
  • A Tanja Markovic je zasluzila bar baraz..jer mnogi su otisli a nisu zasluzili..nista losija nije bila od nekih koje ste pustili u baraz..mogla je i ona..meni se svidjelo njeno pjevanje

    Maida ŠečićMaida ŠečićПре 2 дана
  • Sramota da Nikolina Milosavljevic u prvoj pjesmi nije dobila ni jednog glasa..Neznam sta nije valjalo..Meni jako korektno otpjevala obe pjesme

    Maida ŠečićMaida ŠečićПре 2 дана
    • takmicare sa svojim prostackim komentarima..

      bofooit gojobofooit gojoПре 2 дана
  • Šta je sa emisijom od 22.3.2020. ??

    Amer KaršićAmer KaršićПре 2 дана
  • izvinite pa nesto nema emisija 27

    dimitrina stefanovadimitrina stefanovaПре 2 дана
  • jer realno da ovaj tijanin miroslav avramovic nije prosao decko extra peva a i bukv su hteli da mu daju direktan prolaz a posle ga izbacise ja ne razumem

    Jelena MJelena MПре 3 дана
  • Jao Sasa Popovicu seljacino ogavna "jedva cekamo da nas bacite na kolena, pogotovo Jelenu"... FUJ STOKO

    bouytt guytbouytt guytПре 3 дана
  • na takvoj jednoj sceni s milionskim pregledima

    dutoiu hourdutoiu hourПре 3 дана
  • Zasto ne objavljuju novu emisiju

    Kiki RikiKiki RikiПре 3 дана
  • zasto ove nedelje nisu isle zvezde granda msm znam da je korona ali kni imaju 2,3 emisije snimane unapred

    Jelena MJelena MПре 4 дана
    • Sanja, skrati malo. Postajes dosadna sa suvisnim komentarima.🦸‍♀️🤡🦜🐑 Tvoje haljine su isto bezveze. Te duge, te duge sa plastom,te mini sa napunpanim rukavima, te

      bouytt guytbouytt guytПре 3 дана
  • Jovana je odlicna,trebala je dobiti sve glasove

    butti fdftbutti fdftПре 4 дана
    • nameci se. 🙉🍀🌺💁‍♀️💁‍♂️

      dutoiu hourdutoiu hourПре 3 дана
  • ovaj bosanac retardirani nekulturni da pljune zvaku !!!

    Ivan MaricIvan MaricПре 4 дана
  • Sanela toppp 🙋🙋 Vrh... Prsti mala od seksepila😱

    Milan MilanMilan MilanПре 4 дана
  • A STO NEMA NOVE EMISIJE na youtube????

    Srpska Dijaspora Francuske, Paris, FRSrpska Dijaspora Francuske, Paris, FRПре 4 дана
    • Ne znam zasto se cude kada muslimana pitaju za horoskop,kada dobiju odgovor kao od ovog momka da on ne zna sta je u horoskopu. Muslimanima je zabranjeno da vjeruj

      butti fdftbutti fdftПре 4 дана
  • Bravo vanja....izgledas divno i prelepo si otpevala👏👏👏👏👏

    Branka StajicBranka StajicПре 4 дана
  • Zašto nema posljednje emisije zvezde grada granda 😥

    Mirza SamardzicMirza SamardzicПре 4 дана
    • Nemam nijednog TV kanala preko kojeg bih mogao gledati moj najomiljeniji show,pošto živim u "zabiti",molim vas da mi to omogućite bar preko you tuba,a vjerujem da nisam jedini koji bi to želio,ima sigurno još netko tko bi volio da još koji put pogleda.....HVALA

      Mirza SamardzicMirza SamardzicПре 3 дана
  • zasto je emisija od 21.03.2020 remove na you tube ????

    Ljupka ValanLjupka ValanПре 4 дана
  • Ziri pojedininci kako samo odvratni..izula se tuka i digla noge na sto, sta umisljas ja sam neka zvijezda mogu sta hocu...seljacine...pogledajte malo te emisije istog tipa po Engleskoj Njemackoj SAD-u...ziri je daleko ozbiljniji nego ove sprdacine..dosle tu da glume neku visinu..nepostovanje same emisije i takmicara..al i sam Sasa nepostuje takmicare sa svojim prostackim komentarima..

    Serbischer StolzSerbischer StolzПре 4 дана
  • ZAšto nemam snimak 27 emisije ZG

    Munsifa MemićMunsifa MemićПре 4 дана
  • Novice svaka cast,I glas I stas,ma veliko bravooo♥️♥️

    Sanja PavicevicSanja PavicevicПре 4 дана
    • Hii Im from Turska. Anyone can send me Serbian music list because i like Serbian music 😊

      drttyu liqmdrttyu liqmПре 4 дана
  • Hat

    Mara EvtimovaMara EvtimovaПре 4 дана
    • Sramota kako je izbacila grudi Natasa,a jos sramotnije sto Sasa onako komentarise to ne lici odvratno

      drttyu liqmdrttyu liqmПре 4 дана
  • Što je Rijad otpjevao. Bravo momčino 👏👏👏👏👏

    negrinnegrinПре 5 дана
  • Tijanu Dapcevic od sledece sezone u ziri

    drttyu liqmdrttyu liqmПре 5 дана
  • Ova bez vezna Karleusha pojma nema o pjevanju. Samo se drechi kao budala kakva, kao Banshee.

    Nada JekicNada JekicПре 5 дана
  • Zasto nema zvede grand ?pozdrav iz Canade

    Darko BoshkoskiDarko BoshkoskiПре 5 дана
  • Sanja, skrati malo. Postajes dosadna sa suvisnim komentarima.🦸‍♀️🤡🦜🐑 Tvoje haljine su isto bezveze. Te duge, te duge sa plastom,te mini sa napunpanim rukavima, te asimetricne, te delom transparentne...itd..💃🦹‍♀️ Dosadna si, iako se trudis da stylingom uvek budes nova. Lepa si prirodno, ali nesto iz unutra fali. Nedostaje harizma. Ne nameci se. 🙉🍀🌺💁‍♀️💁‍♂️

    Koja SchauerKoja SchauerПре 5 дана
    • Pocele su kemalove pjesme konacno da se pjevaju

      drttyu liqmdrttyu liqmПре 5 дана
  • Ajoj Voje jeste dosadan tamo..samo smara ljude, bas pretjeruje..

    Serbischer StolzSerbischer StolzПре 5 дана
  • Ogledajte se na the voice uk kako se drzi zirito so peacite...so pocit

    donna williamsdonna williamsПре 5 дана
  • A di je emisija od sinoc

    Nera SantricNera SantricПре 5 дана
    • Da , upravo Sam htjela da ostavim isto pitanje . Gdje je zadnja emisija drugog druga. Da li je uopste emitovana

      Mira KnezevicMira KnezevicПре 4 дана
  • Ne znam zasto se cude kada muslimana pitaju za horoskop,kada dobiju odgovor kao od ovog momka da on ne zna sta je u horoskopu. Muslimanima je zabranjeno da vjeruju i citaju horoskop,izricanje buducnosti,gatanje,gledanje u šoljicu kafe,itd itd To je zabranjeno istinskim muslimanima jer niko buducnost ne zna osim Allaha.Citate horoskop i neko tamo N.N lice vam kaze sutra ce vam se desiti to i to,bicete zdravi ili bolesni ili zaljubit ce te.To niko ne zna osim Gospodara!!

    Damask 2017Damask 2017Пре 5 дана
    • Avdo Škokan ovaj žiri budale samo znaju da zajebaju kad neko zna pjeva ma jebo si im mater sa pjesmama pogotovo jeleni podržaje te tvoj #TEŠANJ

      senni bgonsenni bgonПре 5 дана
  • Jel su se emitovale zvezde granda 21og? Nema nista na youtube-u...

    Dusica SDusica SПре 5 дана
    • AU DJORDJE sto te nabrzi Jelena (i neka je) al sto ti ga mala zavuce i okrenu ledja na kraju. Poklopac ! hahahaah TOP ! ! 2:04:06

      laskin riubnlaskin riubnПре 5 дана
  • A gdje je epizoda od jucer

    Katja HiraKatja HiraПре 5 дана
    • Avdo Škokan ovaj žiri budale samo znaju da zajebaju kad neko zna pjeva ma jebo si im mater sa pjesmama pogotovo jeleni podržaje te tvoj #TEŠANJ

      laskin riubnlaskin riubnПре 5 дана
  • Hoce li biti emisija od sinoc? Je li emitovana?

    Dupla SkorpijaDupla SkorpijaПре 6 дана
    • Donijeli su odluku zbog trenutne situacije da nece bit emisije 2 kruga one sto su snimljene vec prije.

      Angel 28Angel 28Пре 4 дана
    • U BiH (novaBH) je išla repriza neke od prethodnih... Ne znam je li to greškom ili namjerno, jer trebalo je da imaju snimljenu tu zadnju iz 2. kruga (koja je trebala ići sinoć, ali nije). Možda su to namjerno odradili svugdje, a možda je kod nas greška. Ako je namjerno, onda neće biti.

      Sabko BdsSabko BdsПре 5 дана
    • I ja cekam kad ce ..

      Josipa SetkaJosipa SetkaПре 5 дана
  • Zašto nije izašla nova epizoda

    Dragana PeracDragana PeracПре 6 дана
  • Pa gde je emisija od 21.03 Dobila virus

    Bada radulovicBada radulovicПре 6 дана
    • Karleusa vise dosadila s njenom pricom svaki put "kako vodis ljubav, tako i pjevas"... Daj, smisli nesto novo, ponavljas se a mislis da si zanimljiva! Viki dama!

      senni bgonsenni bgonПре 5 дана
  • Sramota kako je izbacila grudi Natasa,a jos sramotnije sto Sasa onako komentarise to ne lici odvratno

    Teodora GjorgjevskaTeodora GjorgjevskaПре 6 дана
  • Hii Im from Turska. Anyone can send me Serbian music list because i like Serbian music 😊

    Kaan En eski TürkKaan En eski TürkПре 6 дана
  • Corona virus

    Kalifornija DubiozaKalifornija DubiozaПре 6 дана
  • Cujem zaustavljeno snimanje Zvezda Granda. Iskreno bojim se da ce se ova sezona potpuno odgoditi...😖😟

    Mr NilssonMr NilssonПре 6 дана
    • @senni bgon a da ti odgovaras na ono o cemu je originalan komentar, a ne na svakom komentaru ostavljas odgovore koji veze nemaju s onim o cemu covjek prica

      Prende BoreasPrende BoreasПре 5 дана
    • Zbog čega ovaj žiri sedi ovde ako Saša sve iskomentariše i koriguje? Zašto onda Popović ne sedne na njihovo mesto a ne ovako da nas iritira

      senni bgonsenni bgonПре 6 дана
  • U ovoj Nataliji Joksimović vidim Teodoru Džehverović zaista😍😍

    Martin RadulovskiMartin RadulovskiПре 6 дана
  • Pocele su kemalove pjesme konacno da se pjevaju

    laskin riubnlaskin riubnПре 6 дана
  • Novica je najboljiiiiii 👏🏻👏🏻👏🏻

    Leena lalicicLeena lalicicПре 6 дана
  • Vanja Knezevic pokidala!

    Dusan JovanovicDusan JovanovicПре 6 дана
  • Pocele su kemalove pjesme konacno da se pjevaju

    cnmmd qiuoocnmmd qiuooПре 7 дана
    • Rijad i Sanela najbolji 👏👏💟

      laskin riubnlaskin riubnПре 6 дана
  • Karleusa vise dosadila s njenom pricom svaki put "kako vodis ljubav, tako i pjevas"... Daj, smisli nesto novo, ponavljas se a mislis da si zanimljiva! Viki dama!

    senni bgonsenni bgonПре 7 дана
  • Avdo Škokan ovaj žiri budale samo znaju da zajebaju kad neko zna pjeva ma jebo si im mater sa pjesmama pogotovo jeleni podržaje te tvoj #TEŠANJ

    Mustafaa 13Mustafaa 13Пре 7 дана
    • @Kalifornija Dubioza baš tako

      Mustafaa 13Mustafaa 13Пре 6 дана
    • Jebena Krmeljusa i nezna pjevati samo se zna skidati gola i pokazivati plasticnu guzicu i sise i zna se jahati sa Vranjesom. Ona treba da uci od mnogih pjevaca kako se pjeva. Koza plasticna luda.

      Kalifornija DubiozaKalifornija DubiozaПре 6 дана
  • AU DJORDJE sto te nabrzi Jelena (i neka je) al sto ti ga mala zavuce i okrenu ledja na kraju. Poklopac ! hahahaah TOP ! ! <a href="#" class="seekto" data-time="124">2:04</a>:06

    PosejdonPosejdonПре 7 дана
    • Da li je počelo snimanje trećeg kruga pre zabrane?

      senni bgonsenni bgonПре 7 дана
  • Avdo brat me sjetio na Adisa Topcagic bravo MAJSTORE ne daj ovoj zlobi

    ivano turinaivano turinaПре 7 дана
    • Naslovna slika kao lobi u pubgu :D

      cnmmd qiuoocnmmd qiuooПре 7 дана
  • RIJAD pa deset mjesta ,,,BOG te miluje sreco,,

    annag coclannag coclПре 8 дана
  • Dorđe nema kalibra za ovu emisiju i trebalo bi naći zreliju ličnost. A i drugi mentori prave se toliko mega pametni artisti, a zapravo neznaju raditi sa kandidatima. Mladima treba dati podršku, a ne silovati ih svojom "veličinom" na svaki način.

    gucagucagucagucagucagucaПре 8 дана
  • Edis Struja nepravedno ispao 👎👎👎🤷‍♂️😐

    Alen VaresevicAlen VaresevicПре 8 дана
  • Zbog čega ovaj žiri sedi ovde ako Saša sve iskomentariše i koriguje? Zašto onda Popović ne sedne na njihovo mesto a ne ovako da nas iritira

    Katarina StankovicKatarina StankovicПре 8 дана
    • @annag cocl ko?

      Katarina StankovicKatarina StankovicПре 7 дана
    • je od struke i pametna i kulturna i kad se zeza to je damski,,,a za tvoju fotelju bi bila pareksalans!!!!!jedina kompetentna u ZG,,,,

      annag coclannag coclПре 8 дана
  • Poslusajte rs-projects.info/it/video/osJ_mGSydqeWr9Q 👌👌👌😊😊

    Disrk18 90Disrk18 90Пре 8 дана
  • Hahaha Natalija Joksimovic je idealna za panik i samo za panik... kakav prolaz direkno... a Zoran Petrovic 3 glasa! majko mila jer ovaj ziri lud pijan ili je je*an u mozak!!! Fuj bre

    Nenad MarkovicNenad MarkovicПре 8 дана
  • Jelena je rodjena "narcis" boze me sacuvaj. Niko ne postoji vise nego samo ona. Takmicari pevaju a ona slika sebe u pozira. Strasno los karakter

    Nada PesicNada PesicПре 8 дана
  • Serifovicka je sad pokazala koliko je kontradiktorna.. prošle godine si bila Natašina mentorka,a sad ju pljuješ..bolje da si šutjela 🐄

    ivan segovicivan segovicПре 8 дана
  • Kandidat broj 1 je najbolji

    Elmedin 125Elmedin 125Пре 8 дана
  • Rijad i Sanela najbolji 👏👏💟

    vliduu zeebvliduu zeebПре 8 дана
  • NOVICA BULATOVIC ❤❤❤❤❤❤❤❤

    Kristina BujisicKristina BujisicПре 8 дана
  • VIKI NAJBOLJA💗

    Kornelija DravinskiKornelija DravinskiПре 8 дана
  • Naslovna slika kao lobi u pubgu :D

    Danijela PavlovicDanijela PavlovicПре 8 дана
    • Kad baba Ana govori kandidatima kako se pevaju rokerske pesme!Majko moja!Dno dna!Idi baba u penziju!

      vliduu zeebvliduu zeebПре 8 дана
  • Da li je počelo snimanje trećeg kruga pre zabrane?

    Dimitrije StefanovicDimitrije StefanovicПре 8 дана
  • Ovaj David ko iz Cirkusa da je. Sta izvodi. Lik misli da je muška JK. Ajde menjajte ga vec, gladati ga ne mogu.

    Dan Z. MashupsDan Z. MashupsПре 9 дана
    • Pokusava na taj nacin da se prica o njemu i ostavi neki utisak posebnog...a tip ispada smijesan, vjecno u dupetu JK ...ulizica

      Serbischer StolzSerbischer StolzПре 5 дана
  • Na sta se vi lozite?Na Avda Skokana ili kako god..stv ste seljoberi..

    Milos KrsticMilos KrsticПре 9 дана
  • Jovana ispala u baražu, nije ni ona nesto vau, ali ona ispala a Natalija koja se dere prosla direktno, uzas xD

    Zvezdica SjajnaZvezdica SjajnaПре 9 дана
  • Natalija ova prosla, katastrofa je, falsira, dere se, piskav glas, tekst nerazumljiv kad je prvu pjesmu pjevala. Na osnovu cega je zasluzila prolaz? Uzas

    Zvezdica SjajnaZvezdica SjajnaПре 9 дана
    • Nista bolje nije pevala ni u prvom krugu. Meni je i tada bilo cudo sto su je pustili direktno. I onda je unakazila obe pesme isto kao i sada. U toj emisiji je bilo dosta losih kandidata pre nje, a ona jeste bila malo bolja od njih. Zato je i dobila sve glasove, ali zaista je ispod proseka.

      Aleksandar KnezevicAleksandar KnezevicПре 9 дана
  • Sasa postajes bas seljacina,,,i stavi Viki na tvoje mjesto bila bi savršena za tu ulogu,,,,makni se odi dostojanstveno dok se nisi do kraja zasro ,,,i dozvoli Viki da kaze sto misli jer je od struke i pametna i kulturna i kad se zeza to je damski,,,a za tvoju fotelju bi bila pareksalans!!!!!jedina kompetentna u ZG,,,,

    Josipa JurisicJosipa JurisicПре 9 дана
  • To bre Crnogorac!!!❤️❤️❤️

    Emili HajdarEmili HajdarПре 9 дана
  • Evo, ne nadam se više da će Sanjini komentari postati inteligentniji i da će nešto doprinjeti emisiji.

    gucagucagucagucagucagucaПре 9 дана
  • Tijanu u žiri u iducoj sezoni umjesto Đorđa

    DBDBПре 9 дана